View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10773_high_4 (Length: 238)
Name: NF10773_high_4
Description: NF10773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10773_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 1753018 - 1752808
Alignment:
| Q |
16 |
agagagaggaatgagaacaagaagagcgtaggatcgaacgaagttgagatttagattcgttacgttaggtggtttct-ttatcttggttttgttgttccg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| || || || ||||||||||| |
|
|
| T |
1753018 |
agagagaggaatgagaacaagaagagcgtaggatcgaa----gttgagatttagattcgttatgttaggtgctttctcttgattttgtgttgttgttccg |
1752923 |
T |
 |
| Q |
115 |
ttttggaacacgagatctgaaatgggctgaacattatttgggcttattgggtttgggctcttatatgggagaactgaatcaat-----atcaataaattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||| | |
|
|
| T |
1752922 |
ttttggaacacgagatctgaaatgggctgaacattatttgggcttattgggtttgggctcttatatggga--actcaatcaatcaataatcaataaatct |
1752825 |
T |
 |
| Q |
210 |
tacaaaagagaatagtc |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1752824 |
tacaaaagagaatagtc |
1752808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University