View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10773_low_9 (Length: 223)
Name: NF10773_low_9
Description: NF10773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10773_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 38792234 - 38792128
Alignment:
| Q |
1 |
gccaagattacattgtcgttacgatgtttttagtttgaactgttgtctgattttctgcagtcacgacatgagggtctgcatgattggttgttccggtgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38792234 |
gccaagattacattgtcgttacgatgtttttagtttgaactgttgtctggttttctgcagtcacgacatgagagtctgcatgattggttgttccggtgat |
38792135 |
T |
|
| Q |
101 |
gattggc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
38792134 |
gattggc |
38792128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University