View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10775_low_12 (Length: 249)
Name: NF10775_low_12
Description: NF10775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10775_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 103 - 234
Target Start/End: Original strand, 43486564 - 43486695
Alignment:
| Q |
103 |
atttgcactatgaacagaagcttgttttgccccaaatcccaatatagatatgaacttggacagaagcttcttcattaagcgattctgtgtgatcatggta |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486564 |
atttgcactatgaacagaagcttgttttgccccaaatcccaatatagatatgaacttggacagaagcttcttcattaagcgattctgtgtgatcatggta |
43486663 |
T |
 |
| Q |
203 |
gagctctatacttcttatatactaatgcttgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43486664 |
gagctctatacttcttatatactaatgcttgt |
43486695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 6 - 108
Target Start/End: Complemental strand, 43483933 - 43483831
Alignment:
| Q |
6 |
agaagcaaaggagaacaaaaatcacttgtagaatgcgtttgttttgtgaagcaaccatcttaaaagttaaaagcaatttagacttgtgtagtatatgatt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483933 |
agaagcaaaggagaacaaaaatcacttgtagaatgcgtttgttttgtgaagcaaccatcttaaaagttaaaagcaatttagacttgtgtagtatatgatt |
43483834 |
T |
 |
| Q |
106 |
tgc |
108 |
Q |
| |
|
||| |
|
|
| T |
43483833 |
tgc |
43483831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University