View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10775_low_14 (Length: 237)
Name: NF10775_low_14
Description: NF10775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10775_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 38532918 - 38533123
Alignment:
| Q |
17 |
actttcttgtcttcggacttggccatgattctctcatgtgggcttcgtttaacccaggtggcaacacattattccttgaagaagatcctaaatgggttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532918 |
actttcttgtcttcggacttggccatgattctctcatgtgggcttcgtttaacccaggtggcaacacattattccttgaagaagatcctaaatgggttca |
38533017 |
T |
|
| Q |
117 |
aaccgttcttaaagatgcaccgggccttcgagcccataccgttcgttatcgaacccagcttcgtgaagccaacaaactcatctcctcctaccgcaaggaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38533018 |
aaccgttcttaaagatgcaccgggccttcgagcccataccgttcgttatcgaacccagcttcgtgaagccagcaaactcatctcctcctaccgcaaggaa |
38533117 |
T |
|
| Q |
217 |
cctatg |
222 |
Q |
| |
|
|||||| |
|
|
| T |
38533118 |
cctatg |
38533123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 94 - 139
Target Start/End: Complemental strand, 34715467 - 34715422
Alignment:
| Q |
94 |
gaagaagatcctaaatgggttcaaaccgttcttaaagatgcaccgg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
34715467 |
gaagaagatcctaaatgggttcaaaccgttctcaaagacgcaccgg |
34715422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University