View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10775_low_5 (Length: 352)
Name: NF10775_low_5
Description: NF10775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10775_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 47923090 - 47922759
Alignment:
| Q |
1 |
ttgttcgttcgtgggttgattgctagaggtctattatcagattatatgctttctggtttgctaatcaaagaactatgtttttgcttttagtttaacttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47923090 |
ttgttcgttcgtgggttgattgctagaggtctattatcagattatatgcttattggtttgctaatcaaagaactatgattttgcttttagtttaacttct |
47922991 |
T |
|
| Q |
101 |
attagatcatatgctttttagtttgctagtaaaggcaatatgtctctcaaacagatgcctatcttgttttatgcttttttgttaagcttgattatgacta |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47922990 |
attagatcgtatgctttttagtttgctagtaaaggcaatatgtctctcaaacagatgcctatcttgttttatgcttttttgttaagcttgattatgacta |
47922891 |
T |
|
| Q |
201 |
tgactgtcttggcttgnnnnnnnnnnnnnnnnnnnnnnncggtcactaatgaatcgagagtgattattgatgggaaaagtaccaaaaagtatctagtatg |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47922890 |
tgactgtcttggcttgttttttttctctttactttttttcggtcactaatgaatcgagagtgattattgatgggaaaagtaccaaaaagtatctagtatg |
47922791 |
T |
|
| Q |
301 |
aaccgcttgcttgttaaggtgcactagtttat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47922790 |
aaccgcttgcttgttaaggtgcactagtttat |
47922759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 670484 - 670394
Alignment:
| Q |
23 |
ctagaggtctattatcagattatatgctttctggtttgctaatcaaagaactatgtt--tttgcttttagtttaacttctattagatcatatgc |
114 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||| ||||| |||||||||| | ||||||||||||||| |||||||||||| |||||| |
|
|
| T |
670484 |
ctagaggtctatta---gattacatgctttccagttttctaattaaagaactatatacgtttgcttttagtttaccttctattagattatatgc |
670394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 39 - 103
Target Start/End: Original strand, 28239768 - 28239832
Alignment:
| Q |
39 |
agattatatgctttctggtttgctaatcaaagaactatgtttttgcttttagtttaacttctatt |
103 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||| ||| |||||||||||||| || ||||||||| |
|
|
| T |
28239768 |
agattacatgctttctagtttgctaatttaaggactttgtttttgcttttaattgcacttctatt |
28239832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University