View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10776_low_1 (Length: 417)
Name: NF10776_low_1
Description: NF10776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10776_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 97 - 402
Target Start/End: Complemental strand, 15936133 - 15935828
Alignment:
| Q |
97 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15936133 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta |
15936034 |
T |
|
| Q |
197 |
gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg |
296 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936033 |
gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg |
15935934 |
T |
|
| Q |
297 |
tggacgaaaagttcgacccactcattcggcaagtggccatcagattggcaaacaaggtcccttacctccccaaatttgtgatatctcgtctccccgacga |
396 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
15935933 |
tggacgaaaagttcgacccgctcattcggcaagtggccatcagattggcaaacaaggtctcttacctccccaaatttgtaatatctcgtctctccgacga |
15935834 |
T |
|
| Q |
397 |
tgaatt |
402 |
Q |
| |
|
|||||| |
|
|
| T |
15935833 |
tgaatt |
15935828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University