View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10776_low_10 (Length: 202)
Name: NF10776_low_10
Description: NF10776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10776_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 35212985 - 35213153
Alignment:
| Q |
15 |
atgaaggtagtgaagcgttggttttgaaatgaaagctgatgatgatgatgggagaggaagttattagagttggatgatgataatgcaaatttgtggtgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35212985 |
atgaaggtagtgaagcgttggttttgaaatgaaagctgatgatgatgatgggagaggaagttattagagttggatgatggtaatgcaaatttgtggtgtt |
35213084 |
T |
 |
| Q |
115 |
taaataagatgaaattgttgggtgataatagaattgatgagctcatgaagaacattaatgataaatgcc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213085 |
taaataagatgaaattgttgggtgataatagaattgatgagctcatgaagaacattaatgataaatgcc |
35213153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University