View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10776_low_3 (Length: 320)
Name: NF10776_low_3
Description: NF10776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10776_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 274
Target Start/End: Complemental strand, 12325610 - 12325357
Alignment:
| Q |
11 |
cataggatatgctatttgcagcttagcacaaaagagctttgttggttcagaatagcctactatatcaatgttgcttcatattgacatggtatcattcttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12325610 |
cataggatatgctatttgcagcttagcacaaaagagctttgttggttcagaatagccta----------gttgcttcatattgacatggtatcattcttt |
12325521 |
T |
|
| Q |
111 |
aggaaatgagaagttcttctcagaaatcagaatagtctactatactatttaaatcaaatgcaggtgtgaaactaacatgttattattggatcaggttcat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12325520 |
aggaaatgagaagttcttctcagaaatcagaatagtctactatactatttaaatcaaatgcaggtgtgaaactaacatgttattattggatcaggttcat |
12325421 |
T |
|
| Q |
211 |
atcagatatcttattgctactgtgctttgattgtaatctatatgtacttgctagtttctaactt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12325420 |
atcagatatcttattgctactgtgctttgattgtaatctatatgtacttgctagtttctaactt |
12325357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University