View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10777_low_1 (Length: 249)
Name: NF10777_low_1
Description: NF10777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10777_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 25 - 241
Target Start/End: Original strand, 35775847 - 35776063
Alignment:
| Q |
25 |
tcgtttcatacctactttatgttcttcatcagataataggcagatctacatatgttgacaatgatttggggaatgaattttcaaagatggatgtttgtgt |
124 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35775847 |
tcgtttcatacctactttatgttcttcgtcagataataggcagatctacatatgttgacaatgatttggggaatgaattttcaaagatggatgtttgtgt |
35775946 |
T |
|
| Q |
125 |
tgagaagaagacataatatgggttattcatctgttttgcattctgaaacctttagcatagacctcacctcaccatattaggatcttaaaaatcaaaatgg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35775947 |
tgagaagaagacataatatgggttattcatctgttttgcattctgaaacctttagcatagacctcacctcaccatattaggatcttaaaaatcaaaatgg |
35776046 |
T |
|
| Q |
225 |
aaaacattgtctctgct |
241 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35776047 |
aaaacattgtctctgct |
35776063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 25 - 106
Target Start/End: Original strand, 39500537 - 39500618
Alignment:
| Q |
25 |
tcgtttcatacctactttatgttcttcatcagataataggcagatctacatatgttgacaatgatttggggaatgaattttc |
106 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
39500537 |
tcgtttcatacctactttatgttcttcgtcaaataataggcagatctacatatgttggcaatgatttagggaatggattttc |
39500618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University