View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10777_low_2 (Length: 237)
Name: NF10777_low_2
Description: NF10777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10777_low_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 45549975 - 45550211
Alignment:
| Q |
1 |
tggtggattgttttgatgaattcctgggtgtcatttctctccctctgtctttggagataattgacttttgaaccacgatatggtcccgagacttcttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549975 |
tggtggattgttttgatgaattcctgggtgtcatttctctccctccgtctttggagataattgacttttgaaccacgatatggtcccgagacttcttttc |
45550074 |
T |
 |
| Q |
101 |
attgctcatcttaatatgcttgtttgtgattgtttgtccttcctttgcaatttgaatggcaggtttaacttgtgatcttctttcgtgcatgttatttaga |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550075 |
attgctcatcttaatatgcttgtctgtgattgtttgtccttcttttgcaatttgaatggcaggtttaacttgtgatcttctttcgtgcatgttatttaga |
45550174 |
T |
 |
| Q |
201 |
ttatgaaatggatcattgccatttatgcttctatcct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45550175 |
ttatgaaatggatcattgccatttatgcttctgtcct |
45550211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University