View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10779_low_10 (Length: 249)
Name: NF10779_low_10
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10779_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 43611361 - 43611600
Alignment:
| Q |
1 |
tcaaagaagcatgttaagtggaaaggagcagaaaccttgaccctgtatcagaatcgttgttgggagttatgtcaagagaacgcaaaagactcccgaggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43611361 |
tcaaagaagcatgttaagtggaaaggagcagaaacctggaccctgtatcagaatcgttgttgggagttatgtcaagagaacgcaaaagactcccgaggct |
43611460 |
T |
|
| Q |
101 |
aagagcatactcagagagcatagacttttgcggttgaagctgtatatcctgatagaccttcccatttccattcccggtttgaaggatgtcgtcattggca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43611461 |
gagagcatactcagagagcatagacttttgcggttgaagctgtatatcctgatagaccttcccatttccattcccggtttgaaggatgtcgtcattggca |
43611560 |
T |
|
| Q |
201 |
tagtttgaattgtttccattggccacaacccgtgtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43611561 |
tagtttgaattgtttccattggccacaacccgtgtctctg |
43611600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University