View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10779_low_14 (Length: 236)
Name: NF10779_low_14
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10779_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 36370537 - 36370330
Alignment:
| Q |
14 |
atgaattatgttaacttggtacacatcaaaataatcagttatacagtaaacaacacttgtggaagcaggtacaaaatagaattcaaacgaagctgtttag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36370537 |
atgaattatgttaacttggtacacatcaaaataatcagttatacagtaaacaacacttgtggaagcaggtacaaaataatattcaaacgaagctgtttag |
36370438 |
T |
 |
| Q |
114 |
tgtataaggtgaaaacttagaaataaacctctcatcaatatatagggggacgtatttggatccatatgagattcatatataatataatcaatcagacaag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36370437 |
tgtataaggtgaaaacttagaaataaacctctcatcaatatatagggggacttatttggatccatatgagattcatatataatataatcaatcagacaag |
36370338 |
T |
 |
| Q |
214 |
gttccctc |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
36370337 |
gttccctc |
36370330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University