View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10779_low_16 (Length: 220)
Name: NF10779_low_16
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10779_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 89 - 203
Target Start/End: Original strand, 29959662 - 29959776
Alignment:
| Q |
89 |
agtctacgagatcactgtcaaaatttaattatcagtatgatgcaattttctttttcagtgtgattattatcaaggtacagcaaaagaacaacaatgtccc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959662 |
agtctacgagatcactgtcaaaatttaattatcaatgtgatgcaattttctttttcagtgtgattattatcaaggtacagcaaaagaacaacaatgtccc |
29959761 |
T |
|
| Q |
189 |
agacggcaagaaaag |
203 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29959762 |
agacggcaagaaaag |
29959776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University