View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10779_low_17 (Length: 219)
Name: NF10779_low_17
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10779_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 52075262 - 52075449
Alignment:
| Q |
17 |
agaaggggtttttgagaagttgtggaagtgtccggctccgtcaaaggtggtggctttcgattggagagctattctcaaccggataccaactaaaattaac |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52075262 |
agaagaggtttttgagaagttgtggaagtgtccggctccgtcaaaggtggtggttttcggttggagagctattctcaaccggataccaactaaaattaac |
52075361 |
T |
 |
| Q |
117 |
ctcacattgagacatgtcttaaatgcgggagagcaaccttggtggctttgtgtaatacggtggaggaatccacaaatcaccttcttct |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52075362 |
ctcacattgagacatgtcttaaatccgggagagcaaccttggtggctttgtgtaatagggtggaggaatccacaaatcaccttcttct |
52075449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 24 - 98
Target Start/End: Original strand, 49456430 - 49456504
Alignment:
| Q |
24 |
gtttttgagaagttgtggaagtgtccggctccgtcaaaggtggtggctttcgattggagagctattctcaaccgg |
98 |
Q |
| |
|
||||| |||| ||||||||||| |||||| |||||||||||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
49456430 |
gttttcgagatgttgtggaagtctccggcaccgtcaaaggtggtggctttcgcttggagagcattcctcaaccgg |
49456504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University