View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10779_low_4 (Length: 341)
Name: NF10779_low_4
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10779_low_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 3228749 - 3229089
Alignment:
| Q |
1 |
cttcttgttcaaacgaggctctcttatactcaccacaacctttaggattttttgatttcttctgatctatgagagcttttgacatcactttcagtgccag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3228749 |
cttcttgttcaaacgaggctctcttatactcaccacaacctttaggattttttgatttcttctgatctatgagagcttttgacattactttcagtgccag |
3228848 |
T |
|
| Q |
101 |
atattcttctgatgaccggttaccggttctcgccaggaacacgacgcctttggcgccgcgtcctacggctgagataacttttagggttttgaaatctagt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3228849 |
atattcttctgacgaccggttaccggttctcgccaggaacacgacgcctttggcgccgcgtcctacagctgagataacttttagggttttgaaatctagt |
3228948 |
T |
|
| Q |
201 |
gattttactctgtcgttttggttggtgttgctgtcgttcatggtgannnnnnnaactttgaagtgtagttttgttatgttgaattgtttataggttttta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3228949 |
gattttactctgtcgttttggttggtgttgctgtcgttcatggtgatttttttaactttgaagtgtagttttgttatgttgaattgtttataggttttta |
3229048 |
T |
|
| Q |
301 |
taagacttgtataagcgtgtttggtgggttattgctgcttc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3229049 |
taagacttgtataagcgtgtttggtgggttattgctgcttc |
3229089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University