View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10779_low_8 (Length: 250)
Name: NF10779_low_8
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10779_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 4702780 - 4702852
Alignment:
| Q |
1 |
gtggtcaagtatgccttatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagtttt |
74 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
4702780 |
gtggtcaaatatgccttatgatctgctctcaaatattgcaaataggctggaactgattga-ttttaccagtttt |
4702852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 4706161 - 4706222
Alignment:
| Q |
15 |
cttatgatctgctctcaaatattgcaaatatgctagaactgattgatttttaccagttttcat |
77 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||| ||||||| |||||||| |
|
|
| T |
4706161 |
cttatgatctgctgtcaaatattgcaaataggctggaactgattga-ttttacctgttttcat |
4706222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 4706506 - 4706558
Alignment:
| Q |
102 |
atgactgtattgcagcattttcatctgctcctacatctcaggattgcattgtt |
154 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| |||||||||||||| |||||| |
|
|
| T |
4706506 |
atgactatattgcagcaatttcatctgctcccacatctcaggattgtattgtt |
4706558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University