View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_30 (Length: 325)
Name: NF1077_high_30
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 10 - 288
Target Start/End: Complemental strand, 28206120 - 28205842
Alignment:
| Q |
10 |
aagaaaatggactgtataaattaagattagctcttgcaagtgcaaatgtctctgaattacaggtaaggaacttcatcaaaaactttgaattagttttcca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28206120 |
aagaaaatggactgtataaattaagattagctcttgcaagtgcaaatgtctctgaattacaggtaaggaacttcatcaaaaactttctattagttttcca |
28206021 |
T |
 |
| Q |
110 |
atgtaatcatcaaatttgttaagaagaaaatggtatataaactagtttacactaacatcaaaaataaaaattcaatattttacaattacttttaaaatac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
28206020 |
atgtaatcatcaaatttgttaagaagaaaatggtatataaactagtttacactaacatcaaaaataaaaattcaatattttacgattacttctaaaatac |
28205921 |
T |
 |
| Q |
210 |
ggttataagataagtttatacgaacccacttgagttgatccggtgatattgatttgggatttggaagtgtacttctctt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
28205920 |
ggttataagataagtttatacgaacccacttaagttgacccgatgatattgatttggaatttggaagtgtgcttttctt |
28205842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 232 - 271
Target Start/End: Complemental strand, 46174460 - 46174421
Alignment:
| Q |
232 |
aacccacttgagttgatccggtgatattgatttgggattt |
271 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
46174460 |
aacccacttgggttggtccggtgatattgatttgggattt |
46174421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 289
Target Start/End: Original strand, 12633009 - 12633066
Alignment:
| Q |
232 |
aacccacttgagttgatccggtgatattgatttgggatttggaagtgtacttctcttc |
289 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||||||||| ||||| || |||||| |
|
|
| T |
12633009 |
aacccacttgggttgtcccggtgatattgacttgggatttgggagtgtgctcctcttc |
12633066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University