View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_34 (Length: 315)
Name: NF1077_high_34
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 46 - 195
Target Start/End: Original strand, 29908337 - 29908486
Alignment:
| Q |
46 |
ggatttgaaaaagagggggaaagataaattctcctttgatgtgaatggacatgtaattgaattagcttaaattaattggaggaattgaaggaattcaatc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29908337 |
ggatttgaaaaagagggggaaagataaattctcctttgatgtgaatggacatgtaattgaattagcttaaattaattggaggaattgaaggaattcaatc |
29908436 |
T |
 |
| Q |
146 |
aaaccccacgtgcatcttcaaatcatcctctattccttgataatgacagc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
29908437 |
aaaccccacgtgcatcttcaaatcatcctttattccttgataacgacagc |
29908486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University