View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_48 (Length: 270)
Name: NF1077_high_48
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 29 - 224
Target Start/End: Complemental strand, 47151651 - 47151456
Alignment:
| Q |
29 |
tagctgttgccaaaacagaaggtagataactcataaacttagaatctgcaatgttgtgacaaaacctaagatgagaaacagaacacaaaaactttctcaa |
128 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47151651 |
tagcagttgccaaaacagaaggtagataactcataaacttagaatctgcaatgttgtgacaaaacctaagatgagaaacagaacataaaaactttctcaa |
47151552 |
T |
 |
| Q |
129 |
gatcgaagatatactgtaaatttacctgatctaatgacagagagaagaacaccttcacatctcttaaggaactcccaacaaattagatgatctttc |
224 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
47151551 |
gatcgaagatatactgaaaatttacctgatctaatgacagagagaagaacaccttcacatctcttaagaaactcccaacaaattagatggtctttc |
47151456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University