View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1077_high_49 (Length: 266)

Name: NF1077_high_49
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1077_high_49
NF1077_high_49
[»] chr1 (1 HSPs)
chr1 (146-237)||(35405683-35405776)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 146 - 237
Target Start/End: Original strand, 35405683 - 35405776
Alignment:
146 ggatgaaaaacaaaga--aaataaatgggacaagtaagtctaaaaattagatttatgaagtattaatgacgaagtgtatggtggcagatgcaac 237  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35405683 ggatgaaaaacaaagagaaaataaatgggacaagtaagtctaaaaattagatttatgaagtattaatgacgaagtgtatggtggcagatgcaac 35405776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University