View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_56 (Length: 250)
Name: NF1077_high_56
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 6 - 237
Target Start/End: Complemental strand, 8895736 - 8895507
Alignment:
| Q |
6 |
tcaaaatatcaagtttaattctcgtcaatgtcaatttaggggactaatttatcttcttaaaaaa-gttacataattttagnnnnnnnnncatacatgtat |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||| |||||||||||| | ||||| |||| |
|
|
| T |
8895736 |
tcaaaatatcaagtttaattttcgtcaatgtcaatttaagggactaatttatctttttaaaaaaagttacataatttaaaaaaaaat---atacacgtat |
8895640 |
T |
|
| Q |
105 |
tattcataaagttgttaattaatatgtgccaacataatttggcacaacccaattatctatggagatgaaatattttaaaggctaaacaacttgtactcga |
204 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8895639 |
tattcataaagttgttaattaatacgtaccaacataatttggcacaacccaattatctatggaggtgaaatattttaaaggctaaacaacttgtactcga |
8895540 |
T |
|
| Q |
205 |
cataattgattgtttcttttttcaccctcctct |
237 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
8895539 |
cataattgattatttcttttttcaccctcctct |
8895507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 13831672 - 13831705
Alignment:
| Q |
36 |
tcaatttaggggactaatttatcttcttaaaaaa |
69 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
13831672 |
tcaatttaggggactaatttagcttcttaaaaaa |
13831705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University