View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_61 (Length: 211)
Name: NF1077_high_61
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 47447029 - 47447209
Alignment:
| Q |
18 |
gttgcatcagccagtcaacacgtgtaagaatcaacaattcattcagagcacctaaaagaagcaatactccaatttcttgnnnnnnnnnnnnnnnnnnnnt |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47447029 |
gttgcatcagccagccaacacgtgtaagaatcaacaattcactcagagcacctaaaagaagcaatactccaatttcttgaaaagaaaaagaaaaaa---t |
47447125 |
T |
|
| Q |
118 |
tcgcaaagtctgcatttatccgcttcagatctttctaagaagacagtgttgacaatacaatcttgcacttataatttgatgatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47447126 |
tcgcaaagtctgcatttatccgcttcatatctttctaagaagacagtgttcacaatacaatcttgcacttataatttgatgatg |
47447209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University