View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_63 (Length: 206)
Name: NF1077_high_63
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 47 - 160
Target Start/End: Original strand, 8895927 - 8896040
Alignment:
| Q |
47 |
aatattacaattatcaacaactagccataataaaataaattagaaaccatttctaataattaattgattcccatcattaatccatatagcagattgacta |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8895927 |
aatattacaattatcaacaactagccataataaaataaattagaaaccatttctaataattaattgattcccatcatcaatccatatagcagattgacta |
8896026 |
T |
 |
| Q |
147 |
aaataaacaatcta |
160 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8896027 |
aaataaacaatcta |
8896040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University