View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_high_64 (Length: 205)
Name: NF1077_high_64
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 5 - 147
Target Start/End: Complemental strand, 1048877 - 1048733
Alignment:
| Q |
5 |
caaacttacaaaaactcaaagtcaagcaaatattttccatggactatttatctcttgtcc--accacagactttatgtttttataccgcaatcatattag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048877 |
caaacttacaaaaactcaaagtcaagcaaatattttccatggactatttatctcttgtccccaccacagactttatgtttttataccgcaatcatattag |
1048778 |
T |
 |
| Q |
103 |
taaataaaaatgtagaaaatatattttttaattcctctatatgta |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1048777 |
taaataaaaatgtagaaaatatattttttaattcctctatatgta |
1048733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University