View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_low_33 (Length: 350)
Name: NF1077_low_33
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 28 - 338
Target Start/End: Complemental strand, 54012931 - 54012621
Alignment:
| Q |
28 |
cagatatcacaatcttcaccacactgaaaaggacaccaatttctgcctctttatgcctctctttgacgcattaggcaatactcttaacaaaaattcatgg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012931 |
cagatatcacaatcttcaccacactgaaaaggacaccaatttctgcctctttatgcctctctttgacgcattaggcaatactcttaacaaaaattcatgg |
54012832 |
T |
|
| Q |
128 |
acattacacgaaacattaagttcaggttcaggtaattaacttgtcctatgattaattcactattttcatctaaatattaataatccacattatgataata |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54012831 |
acattacacgaaacattaagttcaggttcaggtaattaacttgtcctatgattaattcactattttcatctaaatactaataatccacattatgataata |
54012732 |
T |
|
| Q |
228 |
aagttgtattgaatctttatcaatgcaggaaatggcactacggtaccacattttgttttcttggctcatatggttgatatctcatcctgcatgcatgttc |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012731 |
aagttgtattgaatctttatcaatgcaggaaatggcgctacggtaccacgctttgttttcttggctcatatggttgatatctcatcctgcatgcatgttc |
54012632 |
T |
|
| Q |
328 |
cgtttgttctg |
338 |
Q |
| |
|
||||||||||| |
|
|
| T |
54012631 |
cgtttgttctg |
54012621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University