View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_low_56 (Length: 283)
Name: NF1077_low_56
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 44 - 224
Target Start/End: Original strand, 35661788 - 35661973
Alignment:
| Q |
44 |
gagcagagagggcccaagctgaagattttgatgctgaggagggggagctaattaaagaggaaaacgagcaggaggaagaagtttttgaccaagttagtat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35661788 |
gagcagagagggcccaagctgaagattttgatgctgaagagggggagctaattaaagaggaaaacgagcaggaggaagaagtttttgaccaagtcagtat |
35661887 |
T |
|
| Q |
144 |
ttct-----ttatacaatttaaaccttcacatttgcttggctgctacctttgtttgctggtcctccttttaaaatatttgacacct |
224 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35661888 |
ttctttgtattatataatttaaaccttcacatttgcttggctgctacctttgtttgctggtcctccttttaaaatatttgacacct |
35661973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University