View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_low_67 (Length: 251)
Name: NF1077_low_67
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_low_67 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 28 - 251
Target Start/End: Complemental strand, 27008758 - 27008533
Alignment:
| Q |
28 |
caaaagaaacagctataggaacaccagctttgaggataataggctttagattttctgctttaagtgttgagttttccatctaaaaagaatatgagaaatt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008758 |
caaaagaaacagctataggaacaccagctttgaggataataggctttagattttctgctttaagtgttgagttttccatctaaaaagaatatgagaaatt |
27008659 |
T |
|
| Q |
128 |
tcagctatttggttagatttt--tgtttatgatcagaattcaagttaaaattgaacaaggtgtttgtttcttatgctataaaaggtttaaaaatgttaca |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
27008658 |
tcagctatttggttagatttttgtgtttatgatcagaattcaagttaaaattgaacaaggtgtttgtttcttatgctataaaaggtttaaagatgttgca |
27008559 |
T |
|
| Q |
226 |
ttgacaaagtttgtatacaaagtttt |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
27008558 |
ttgaaaaagtttgtatacaaagtttt |
27008533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University