View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_low_73 (Length: 249)
Name: NF1077_low_73
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_low_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 26 - 143
Target Start/End: Original strand, 44006216 - 44006333
Alignment:
| Q |
26 |
tgtctatagtaatcggatgtttttctttgnnnnnnnctacaaccaaatgttattatgaaagtgatcaattgtcctgtctaaagtaacatgatgattatgt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006216 |
tgtctatagtaatcggatgtttttctttgaaaaaaactacaaccaaatgttattatgaaagtgatcaattgtcctgtctaaagtaacatgatgattatgt |
44006315 |
T |
 |
| Q |
126 |
cattacggaaagaattat |
143 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
44006316 |
cattacggaaaaaattat |
44006333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University