View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1077_low_78 (Length: 208)

Name: NF1077_low_78
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1077_low_78
NF1077_low_78
[»] chr3 (1 HSPs)
chr3 (1-118)||(41769967-41770084)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 41769967 - 41770084
Alignment:
1 tttgtttagtttttattttggttgataaggtggtccttcttcctttactttcattcatggggaaggtcacaacttcttcaacaccgcctttttctcaaga 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41769967 tttgtttattttttattttggttgataaggtggtccttcttcctttactttcattcatggggaaggtcacaacttcttcaacaccgcctttttctcaaga 41770066  T
101 agcttccaattttgatga 118  Q
    ||||||||||||||||||    
41770067 agcttccaattttgatga 41770084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University