View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_low_78 (Length: 208)
Name: NF1077_low_78
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 41769967 - 41770084
Alignment:
| Q |
1 |
tttgtttagtttttattttggttgataaggtggtccttcttcctttactttcattcatggggaaggtcacaacttcttcaacaccgcctttttctcaaga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41769967 |
tttgtttattttttattttggttgataaggtggtccttcttcctttactttcattcatggggaaggtcacaacttcttcaacaccgcctttttctcaaga |
41770066 |
T |
 |
| Q |
101 |
agcttccaattttgatga |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41770067 |
agcttccaattttgatga |
41770084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University