View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1077_low_81 (Length: 204)

Name: NF1077_low_81
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1077_low_81
NF1077_low_81
[»] chr7 (3 HSPs)
chr7 (1-172)||(29820649-29820820)
chr7 (66-141)||(29828932-29829007)
chr7 (102-139)||(29571408-29571445)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 29820820 - 29820649
Alignment:
1 gtacggttacttcttgtatttgtatattctaacagtttagagtctattctttattactcatcttgaccaattcttcctaatatcaaatgtcaagcatact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29820820 gtacggttacttcttgtatttgtatattctaacagtttagagtctattctttattactcatcttgaccaattcttcctaatatcaaatgtcaagcatact 29820721  T
101 catttgcatgagtttacctgtgttaaaaattcaaaatcacacatgtgttttgctttacctcatatttcatct 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29820720 catttgcatgagtttacctgtgttaaaaattcaaaatcacacatgtgttttgctttacctcatatttcatct 29820649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 66 - 141
Target Start/End: Complemental strand, 29829007 - 29828932
Alignment:
66 accaattcttcctaatatcaaatgtcaagcatactcatttgcatgagtttacctgtgttaaaaattcaaaatcaca 141  Q
    ||||||||| ||||||||||||||||||||||| || ||| |||| ||||| || | ||||||||| |||||||||    
29829007 accaattctgcctaatatcaaatgtcaagcatattcttttacatgggtttaactttattaaaaattgaaaatcaca 29828932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 102 - 139
Target Start/End: Original strand, 29571408 - 29571445
Alignment:
102 atttgcatgagtttacctgtgttaaaaattcaaaatca 139  Q
    ||||| ||||||||| ||||||||||||||||||||||    
29571408 atttgtatgagtttaactgtgttaaaaattcaaaatca 29571445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University