View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1077_low_83 (Length: 203)
Name: NF1077_low_83
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1077_low_83 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 42463924 - 42464046
Alignment:
| Q |
1 |
gtggctacaaaaatgaaggttttgttgaggttcttgctgctcagcaaagtcctgagaatcctaattggttccaggtataacattgccttaactatgtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42463924 |
gtggctacaaaaatgaaggttttgttgaggttcttgctgctcagcaaagtcctgagaatcctaattggttccaggtataactttgccttaactatgtttt |
42464023 |
T |
|
| Q |
101 |
caattagctttcctctttatatt |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42464024 |
caattagctttcctctttatatt |
42464046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 37077989 - 37078065
Alignment:
| Q |
1 |
gtggctacaaaaatgaaggttttgttgaggttcttgctgctcagcaaagtcctgagaatcctaattggttccaggta |
77 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| || |||||||||||| |
|
|
| T |
37077989 |
gtggttacaaaaatgaaggtttcgttgaggttcttgctgcacagcagagtcctgagaatccaaactggttccaggta |
37078065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University