View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10781_high_3 (Length: 250)
Name: NF10781_high_3
Description: NF10781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10781_high_3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 39771560 - 39771802
Alignment:
| Q |
8 |
aagcagagacaactacccacaataatttaaaaacacaaagcaataatggccatatggatcaaacgatagcaaacatgacatgtcaaaatcaaaaggtcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39771560 |
aagcagagacaactacccacaataatttaaaaacacaaagcaataatggccatatggatcaaacgatagcaaacatgacatgtcaaaatcaaaaggtcca |
39771659 |
T |
|
| Q |
108 |
tnnnnnnncatataagcatagttcgcattcaacaattcaaacacacaaccagggttttaaatagaggtctgcatgcgcaatataagctacgtcatcatga |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39771660 |
taaaaaaacatataagcatagttcgcattcaacaattcaaacacacaaccagggttttaaatagaggtctgcatgcgcaatataagttacgtcatcatga |
39771759 |
T |
|
| Q |
208 |
tttttgttattgccacaaccaagattgagaccgcatcaaccac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39771760 |
tttttgttattgccacaaccaagattgagaccgcatcaaccac |
39771802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University