View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10781_low_12 (Length: 224)
Name: NF10781_low_12
Description: NF10781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10781_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 25334024 - 25334216
Alignment:
| Q |
17 |
agatcggatacaaaataaagatctccaatactcgtttagaattttatctggtttaatctatgcgtaatgaacacnnnnnnncctttgcataaacctctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25334024 |
agatcggatacaaaataaagatctccaatactcgtttagaattttatctggtttaatctatgcgtaatgaacactttttttcctttgcataaacctctta |
25334123 |
T |
|
| Q |
117 |
attaattacctcaacaaatccaaataatcgagtcactgacacggctgattcgtgttctagattttacaattatattatctgaacaaattaatt |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25334124 |
attaattacctcaacaaatccaattaatcgagtcactgtcactgctgatttgtgttctagattttacaattatattatctgaacaaattaatt |
25334216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University