View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10782_high_4 (Length: 251)
Name: NF10782_high_4
Description: NF10782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10782_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 44373988 - 44373754
Alignment:
| Q |
1 |
tttcaagcatttcaaaattcataaggcattaccacaagactatgtcaatgtcatcatcatacaatatctgaattgtttgaagaagaagaaaaataaaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44373988 |
tttcaagcatttcaaaattcataaggcattaccacaagactatgtcaatgtcatcat---acaatatctgaattgtttgaagaagaagaaaaataaaaat |
44373892 |
T |
|
| Q |
101 |
aattactactttgctaatacgagaaaatatcgactcattgcttaacattgctattccgttctatttccatatgcagttgacgaaggaattagctggaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44373891 |
aattactactttgctaatacgagaaaatattgactcattgcttaacattgctattccgttctatttccatatgcagttgacgaaggaattagctggaaag |
44373792 |
T |
|
| Q |
201 |
cccataaaagaagcacctgaagaccaaactctccctct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44373791 |
cccataaaagaagcacctgaagaccaaactcttcctct |
44373754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University