View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10782_high_7 (Length: 241)
Name: NF10782_high_7
Description: NF10782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10782_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 35 - 224
Target Start/End: Complemental strand, 30145969 - 30145785
Alignment:
| Q |
35 |
aatgacaaatttatgaattaattgattaggattatatattaatcaactaagagagaagacaattgattagggagattgtgaaatatgaggctgaatatta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30145969 |
aatgacaaatttatgaattaattgattaggattatatattaatcaattaagagagaagacaattgattagggagattgtgaaatatgaggctgaatatta |
30145870 |
T |
 |
| Q |
135 |
aataagcggctctcgtctcgtgtgctttttggcgaaggagacaaaaagaagatttcaattaaaatagtggaaatatctctagtaatacct |
224 |
Q |
| |
|
|||||| ||||||||| | |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30145869 |
aataaggggctctcgtat-----gctttttggcaaaggagacaaaaagaagatttcaatcaaaatagtggaaatatctctagtaatacct |
30145785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 30147400 - 30147364
Alignment:
| Q |
1 |
ttttaagtcaactcaatagtcaattatctttcaaaat |
37 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30147400 |
ttttaagtcaactaaatagtcaattatctttcaaaat |
30147364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University