View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10782_low_13 (Length: 241)

Name: NF10782_low_13
Description: NF10782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10782_low_13
NF10782_low_13
[»] chr8 (2 HSPs)
chr8 (35-224)||(30145785-30145969)
chr8 (1-37)||(30147364-30147400)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 35 - 224
Target Start/End: Complemental strand, 30145969 - 30145785
Alignment:
35 aatgacaaatttatgaattaattgattaggattatatattaatcaactaagagagaagacaattgattagggagattgtgaaatatgaggctgaatatta 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
30145969 aatgacaaatttatgaattaattgattaggattatatattaatcaattaagagagaagacaattgattagggagattgtgaaatatgaggctgaatatta 30145870  T
135 aataagcggctctcgtctcgtgtgctttttggcgaaggagacaaaaagaagatttcaattaaaatagtggaaatatctctagtaatacct 224  Q
    |||||| ||||||||| |     |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
30145869 aataaggggctctcgtat-----gctttttggcaaaggagacaaaaagaagatttcaatcaaaatagtggaaatatctctagtaatacct 30145785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 30147400 - 30147364
Alignment:
1 ttttaagtcaactcaatagtcaattatctttcaaaat 37  Q
    ||||||||||||| |||||||||||||||||||||||    
30147400 ttttaagtcaactaaatagtcaattatctttcaaaat 30147364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University