View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10782_low_6 (Length: 295)
Name: NF10782_low_6
Description: NF10782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10782_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 32133953 - 32133716
Alignment:
| Q |
19 |
ccttgaatagtattacctctggttgagggaatttcttggaaaagtgtttaatgactgatgggtaaataatgaattcgagcaaactaggctgcatcgttgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32133953 |
ccttgaatagtattacctctggttgagggaatttcttggaaaagtgtttaatgactgatgggtaaataatgaattcgagtaaactaggctgcatcgttgg |
32133854 |
T |
|
| Q |
119 |
tcactaggggaatgaggtagcattgacatgaaaatttggtttattttcttgtgattatagattaataatgtatgattttgttctgaacttttacttttgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32133853 |
tcactaggggaatgaggtagcattgacatgaaaatttggtttattttcttgtgataatatattaataatgtatgattttgttctgaacttttacttttgt |
32133754 |
T |
|
| Q |
219 |
taataggcttttagttttactggaatgaatttttctca |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32133753 |
taataggcttttagttttactggaatgaatttttctca |
32133716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University