View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10782_low_7 (Length: 289)
Name: NF10782_low_7
Description: NF10782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10782_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 20 - 279
Target Start/End: Original strand, 52290057 - 52290316
Alignment:
| Q |
20 |
ctttacacgacttagcgtccttctatttgcgctagttaaatctctattctcctttttatcactaaaatttgagatagccttaactttactgtccatagta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290057 |
ctttacacgacttagcgtccttctatttgcgctagttaaatctttattctcctttttatcactaaaatttgagatagccttaactttactgtccatagta |
52290156 |
T |
|
| Q |
120 |
ctagacgaatggaccttctcgtcttccgagaatcttgctaagcaagaaatcaacgattcactttcctcttcattgattttatcaattagaaactcacttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290157 |
ctagacgaatggaccttctcgtcttccgagaatcttgctaagcaagaaatcaacgattcactttcctcttcattgattttatcaattagaaactcacttc |
52290256 |
T |
|
| Q |
220 |
ttcttgaaggaacgtcggatgtacttttccggcctttggatttcactttcttgacctttg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290257 |
ttcttgaaggaacgtcggatgtacttttccggcctttggatttcactttcttgacctttg |
52290316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University