View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10783_22 (Length: 313)
Name: NF10783_22
Description: NF10783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10783_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 213 - 294
Target Start/End: Original strand, 47487168 - 47487254
Alignment:
| Q |
213 |
tgatgatgaatgattagattttcagaatt-----gcatgtcttagtttccatttgaagccttaatatattatatacggatatgatat |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47487168 |
tgatgatgaatgattagaatttcagaattatattgcatgtcttagtttccatttgaagccttaatatattatatacggatatgatat |
47487254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 83
Target Start/End: Complemental strand, 11086392 - 11086319
Alignment:
| Q |
9 |
gttcagttgtttgggtttgggacattcattcaactacgaggaaatcttgcttgatcacaaactattgaacacact |
83 |
Q |
| |
|
||||||| || |||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11086392 |
gttcagtcgtatgggtttggg-cactcattcaactacgaggaaatcttgcttgatcacaaacaattgaacacact |
11086319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 11086320 - 11086392
Alignment:
| Q |
139 |
gtgtgttcaatagtttgtgatcaagcaagatttcctcgtagttgaatgaatgtcccaaacccaaacaactgaac |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||| || ||||||| |
|
|
| T |
11086320 |
gtgtgttcaattgtttgtgatcaagcaagatttcctcgtagttgaatgagtg-cccaaacccatacgactgaac |
11086392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University