View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10783_8 (Length: 478)
Name: NF10783_8
Description: NF10783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10783_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 121 - 277
Target Start/End: Original strand, 1109017 - 1109169
Alignment:
| Q |
121 |
ctgtgaacgatggttcagacatacgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109017 |
ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat |
1109116 |
T |
|
| Q |
221 |
gctacagatcatgtgcagagaaatacgtataaggatgtgaagaagaaagcatatatt |
277 |
Q |
| |
|
||||||||| || |||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
1109117 |
gctacagat---gt-cagagaaatatgtataacgatgtgaagaagaaagcatatatt |
1109169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 51054106 - 51054040
Alignment:
| Q |
30 |
caaaaaccattccacgacctccgacaccgtcgtatttgccacctccggcgcaaatgcatttggattt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51054106 |
caaaaaccattccacgacctccgacaccgtcgtatttgccacctccggcgcaaatgcatttggattt |
51054040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University