View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10784_5 (Length: 318)
Name: NF10784_5
Description: NF10784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10784_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 5 - 139
Target Start/End: Complemental strand, 45545327 - 45545196
Alignment:
| Q |
5 |
ttacagtagttagatatgggttctgcatctgctggggacaagatggacgctgatttcgatgaagagacacctttcagttcaacttcaccttcatctgcat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45545327 |
ttacagtagttagatatgggttctgcatctgctggggacaagatggacgctgatttcgatgaagagacacctttcagttcaacttcaccttcatctacat |
45545228 |
T |
|
| Q |
105 |
ctgctaatacttcttcttcttctgttaaaccacac |
139 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
45545227 |
ctgctaatacttcttc---ttctgttaaaccacac |
45545196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 198 - 308
Target Start/End: Complemental strand, 45545137 - 45545027
Alignment:
| Q |
198 |
attcccgcactagactaatcagcaaaagtatatatatcgtcttaatcaaagctaagatcaacatcttactcccctttggtccttttgccatcttcctaca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545137 |
attcccgcactagactaatcagcaaaagtatatatatcgtcttaatcaaagctaagatcaacatcttactcccctttggtccttttgccatcttcctaca |
45545038 |
T |
|
| Q |
298 |
ctatttctctg |
308 |
Q |
| |
|
||||||||||| |
|
|
| T |
45545037 |
ctatttctctg |
45545027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University