View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10785_4 (Length: 323)
Name: NF10785_4
Description: NF10785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10785_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 3713498 - 3713189
Alignment:
| Q |
1 |
tatcccttatggtagggatggtcaatgagatgtccctagtgtttaaaaatgatctgaaaatacgggttggggagacaaatgtggacccttgatatcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713498 |
tatcccttatggtagggatggtcaatgagatgtccctagtgtttaaaaatgatctgaaaatacgggttggggagacaaatgtggacccttgatatcttca |
3713399 |
T |
|
| Q |
101 |
gcttcgtttcaaggttcatctttccaaacacttgcatgttctcttaaagatccccttctatcccatacaaaacctacatttaatgcaccttctattctaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713398 |
gcttcgtttcaaggttcatctttccaaacacctgcatgttctcttaaagatccccttctatcccatacaaaacctacatttaatgcaccttctattctaa |
3713299 |
T |
|
| Q |
201 |
cattacatataactgaacctagacattcatacaaacattgagtctttattcttgttctgcattttatctcaacatggcttcacttcctcttcttctgctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3713298 |
cattacatataactgaacctagacattcatacaaacattgagtctttattattgttctgcattttatctcaacatggcttctcttcctcttcttctgctc |
3713199 |
T |
|
| Q |
301 |
ctcatcctct |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
3713198 |
ctcatcctct |
3713189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University