View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10785_low_6 (Length: 246)
Name: NF10785_low_6
Description: NF10785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10785_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 22 - 227
Target Start/End: Complemental strand, 49976899 - 49976694
Alignment:
| Q |
22 |
ccatgacctagtctttcattttattttcatggtgcgctattgtgaaaataataaattnnnnnnnnnnttatgttgttttggttatgtgatcactaatgaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
49976899 |
ccatgacctagtctttcattttattttcatggtgcgctattgtgaaaataataaattaaaaaaaaaattatgttgttttggttatgtgattactaatgaa |
49976800 |
T |
|
| Q |
122 |
gaagaagatttaattaattaaataaattactgaattaccaggtggtggggaggtggtgtcaggaagaagttgtttagcatggtgatctctactagagttg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976799 |
gaagaagatttaattaattaaataaattactgaattaccaggtggtggggaggtggtgtcagaaagaagttgtttagcatggtgatctctactagagttg |
49976700 |
T |
|
| Q |
222 |
tcatca |
227 |
Q |
| |
|
|||||| |
|
|
| T |
49976699 |
tcatca |
49976694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University