View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10786_11 (Length: 355)
Name: NF10786_11
Description: NF10786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10786_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 16 - 355
Target Start/End: Original strand, 46630943 - 46631282
Alignment:
| Q |
16 |
agagatggagttttagaagatcatcagcaacagctacaccaacagcttccaaggaattgaataattctgaaattactgcttcaatgacagtgcaaagtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630943 |
agagatggagttttagaagatcatcagcaacagctacaccaacagcttccaaggaattgaataattctgaaattactgcttcaatgacagtgcaaagtac |
46631042 |
T |
|
| Q |
116 |
tgtcattgatattcagaatgagcaaaggaatcatgccattgctgtggctgctgcgacagccgcggcagctgatgcagcagtggcagctgcacaagctgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46631043 |
tgtcattgatattcagaatgagcaaaggaatcatgccattgctgtggctgctgctacagccgcggcagctgatgcagcagtggcagctgcacaagctgca |
46631142 |
T |
|
| Q |
216 |
gctgctgtgatccggttaacttctggttcaaatgaaacatctaaaagtattgaagatgctgctgctgttaaaattcaatgtgtctttcgatctcacttgg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46631143 |
gctgctgtgatccggttaacttctggttcaaatgaaacatctaaaagtattgaagatgctgctgctgttaaaattcaatgtgtctttcgatctcacttgg |
46631242 |
T |
|
| Q |
316 |
tatgaagttagttttcctagtccttgaaattttaagggtc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46631243 |
tatgaagttagttttcctagtccttgaaattttaagggtc |
46631282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University