View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10786_15 (Length: 329)
Name: NF10786_15
Description: NF10786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10786_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 100 - 212
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
| Q |
100 |
taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt |
198 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
42590891 |
taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt |
42590990 |
T |
 |
| Q |
199 |
aatacaagctggtg |
212 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42590991 |
aatacaagctggtg |
42591004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University