View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10786_low_1 (Length: 300)
Name: NF10786_low_1
Description: NF10786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10786_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 9959947 - 9960189
Alignment:
| Q |
16 |
cattttcatcgcagatttaggaaagtgataggattcattaatttttaactgagtttcaatgttcgctatattttattttccttatttattcaagcatgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9959947 |
cattttcatcgcagatttaggaaagtgataggattcattaatttttaactgagtttcaatgttcactatattttattttccttatttattcaagcatgtt |
9960046 |
T |
 |
| Q |
116 |
ctttctttcttttacacaatcttattcaaacatgatattgctatgcacgtttggcattatgtttttgatcttgggctttcctgttctatcagtattaggc |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9960047 |
ctttctttcttttacacaatcttatt-aaacatgatattgctatgcacgtttggcattatgtttttgatcttgggctttcctgttctatcagtattaggc |
9960145 |
T |
 |
| Q |
216 |
accg-atactcagcagacgacaaagcttacttacaatttattcc |
258 |
Q |
| |
|
|||| |||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
9960146 |
accgaatactcagcagaggacaaagcttacctacaatttattcc |
9960189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University