View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10787_high_2 (Length: 459)
Name: NF10787_high_2
Description: NF10787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10787_high_2 |
 |  |
|
| [»] scaffold0571 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 309 - 448
Target Start/End: Original strand, 27279193 - 27279332
Alignment:
| Q |
309 |
ttacttttgacaggaaatggtggatttagtctctctggaagtgaacaacaccatccattttgcaaaaatgaatgattcacaatttcctagtggtattcaa |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27279193 |
ttacttttgacaggaaatggtggatttagtctctctggaattgaacaacaccatccattttgcaaaaatgaatgattcacaatttcctagtggtattcaa |
27279292 |
T |
 |
| Q |
409 |
ccaaactgctcctacacatgtaggcttcttctcttttctt |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27279293 |
ccaaactgctcctacacatgtaggcttcttctattttctt |
27279332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 123 - 313
Target Start/End: Original strand, 27278972 - 27279165
Alignment:
| Q |
123 |
ttacctaaagtgtattttcctaatatgttatactggttagtagatactaacccttattttcttaaataaatatatacctcgaagaataactagtttatag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27278972 |
ttacctaaagtgtattttcctaatatgttatattggttagtagatactaacccttattttcttaaataaatatatacctcgaagaataactagtctatag |
27279071 |
T |
 |
| Q |
223 |
tttctctcnnnnnnnnnnnnnnnctagtccataatttgtggttggagatacaatgtccaacaataaaaattgta---tgtaaattattcttact |
313 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27279072 |
tttctctcaaaaaaaaaaaaaaactagtctatagtttgtggttggagatacaatgtccaacaataaaaattgtatgctgtaaattattcttact |
27279165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 16916073 - 16915980
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16916073 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctaaatccgc |
16915980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 3e-43; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 18431337 - 18431244
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18431337 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatccgc |
18431244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 1014877 - 1014936
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1014877 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaa |
1014936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 120
Target Start/End: Complemental strand, 22787465 - 22787423
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctgg |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
22787465 |
aaattttgccacactaatatgacatgtctagatccgcccctgg |
22787423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 78 - 114
Target Start/End: Complemental strand, 11943706 - 11943670
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11943706 |
aaattttgccacactaatatcaaatgtctagatccgc |
11943670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 82 - 112
Target Start/End: Complemental strand, 6154107 - 6154077
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatcc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6154107 |
tttgccacactaatatgaaatgtctagatcc |
6154077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0571 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0571
Description:
Target: scaffold0571; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 21 - 112
Target Start/End: Original strand, 63 - 154
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
63 |
cctccaatttcaagctatcatcctgacatccaaaatgaggtacgcaaagcttacttgaaattttgccacactaatatgaaatgtctagatcc |
154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 9e-34; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 21 - 114
Target Start/End: Original strand, 46437727 - 46437820
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46437727 |
cctccaatttcaagctatcatcctgacatccaagatgcagtacgcaaagcttacttgaaattttgccacactaatataaaatgtctagatccgc |
46437820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 21 - 74
Target Start/End: Complemental strand, 39786186 - 39786133
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttac |
74 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39786186 |
cctccaatttcaaactatcatcctgacattcaagatgaggtacgtaaagcttac |
39786133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 120
Target Start/End: Original strand, 38663364 - 38663406
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctgg |
120 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
38663364 |
aaattttgccacactaatatgcaatgtctagatccgcccctgg |
38663406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 119
Target Start/End: Original strand, 39781160 - 39781197
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
39781160 |
tttgccacactaatatgcaatgtctagatccgcccctg |
39781197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 119
Target Start/End: Original strand, 43266096 - 43266133
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
43266096 |
tttgccacactaatatgcaatgtctagatccgcccctg |
43266133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 9e-31; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 25 - 113
Target Start/End: Complemental strand, 5013821 - 5013734
Alignment:
| Q |
25 |
caatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatccg |
113 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5013821 |
caatttcaagctatcatcctg-catccaagatgaggcatgtaaagcttacttgaaattttgccacactaatatgaaatgtctagatccg |
5013734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 18819153 - 18819094
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18819153 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaa |
18819094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 24903921 - 24903862
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24903921 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaa |
24903862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 78 - 119
Target Start/End: Original strand, 16693607 - 16693648
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16693607 |
aaattttgccacactaatatgaaatgtctagatccgcccctg |
16693648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Complemental strand, 18816867 - 18816826
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
18816867 |
aaattttgccacactaatatgcaatgtctagatccgcccctg |
18816826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 78 - 112
Target Start/End: Original strand, 595770 - 595804
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatcc |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
595770 |
aaattttgccacactaatatcaaatgtctagatcc |
595804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 5e-23; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 45484067 - 45484126
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45484067 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaa |
45484126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Original strand, 45486353 - 45486394
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
45486353 |
aaattttgccacactaatatgcaatgtctagatccgcccctg |
45486394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 119
Target Start/End: Complemental strand, 11462767 - 11462730
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
11462767 |
tttgccacactaatatgaaatgtctagattcgcccctg |
11462730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 5e-23; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 26905391 - 26905332
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26905391 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaa |
26905332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 36615649 - 36615708
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36615649 |
cctccaatttcaagctatcatcctgacatccaagatgaggtacgtaaagcttacttgaaa |
36615708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 120
Target Start/End: Original strand, 26557644 - 26557686
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctgg |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
26557644 |
aaattttgccacactaatatgacatgtctagatccgcccctgg |
26557686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 120
Target Start/End: Original strand, 52119126 - 52119168
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctgg |
120 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
52119126 |
aaattttgccacactaatatgacatgtctagatccgcccctgg |
52119168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Original strand, 25070869 - 25070910
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
25070869 |
aaattttgccacactaatatgcaatgtctagatccgcccctg |
25070910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Complemental strand, 26903105 - 26903064
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
26903105 |
aaattttgccacactaatatgcaatgtctagatccgcccctg |
26903064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Complemental strand, 28210921 - 28210880
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
28210921 |
aaattttgccacactaatatgcaatgtctagatccgcccctg |
28210880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 78 - 119
Target Start/End: Original strand, 36617935 - 36617976
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
36617935 |
aaattttgccacactaatatgcaatgtctagatccgcccctg |
36617976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 119
Target Start/End: Original strand, 2125769 - 2125806
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
2125769 |
tttgccacactaatatgcaatgtctagatccgcccctg |
2125806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 8904158 - 8904217
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
|||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
8904158 |
cctccaatttcatgctatcatcctgtcatctaagatgaggtacgtaaagcttacttgaaa |
8904217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 45066089 - 45066030
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttacttgaaa |
80 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
45066089 |
cctccaatttcaagctatcttcctgaaatccaagatgaggtacgtaaagcttacttgaaa |
45066030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 112
Target Start/End: Complemental strand, 45065922 - 45065888
Alignment:
| Q |
78 |
aaattttgccacactaatatgaaatgtctagatcc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45065922 |
aaattttgccacactaatatgaaatgtctagatcc |
45065888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 82 - 114
Target Start/End: Original strand, 8904430 - 8904462
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8904430 |
tttgccacactaatatgaaatgtctagatccgc |
8904462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 7e-16; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 17075330 - 17075385
Alignment:
| Q |
21 |
cctccaatttcaagctatcatcctgacatcaaagatgaggtacgtaaagcttactt |
76 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
17075330 |
cctccaatttcaagctatcaacctgacatccaagatgaggtatgtaaagcttactt |
17075385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 82 - 119
Target Start/End: Complemental strand, 9047525 - 9047488
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9047525 |
tttgccacactaatatgaaatgtctagatccgcccctg |
9047488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 82 - 114
Target Start/End: Complemental strand, 424023 - 423991
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
424023 |
tttgccacactaatatgaaatgtctagatccgc |
423991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 81 - 114
Target Start/End: Original strand, 17077002 - 17077035
Alignment:
| Q |
81 |
ttttgccacactaatatgaaatgtctagatccgc |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
17077002 |
ttttgtcacactaatatgaaatgtctagatccgc |
17077035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 119
Target Start/End: Complemental strand, 18108399 - 18108362
Alignment:
| Q |
82 |
tttgccacactaatatgaaatgtctagatccgctcctg |
119 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
18108399 |
tttgccacactaatataaaatgtctagatccgcccctg |
18108362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University