View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10787_low_11 (Length: 337)
Name: NF10787_low_11
Description: NF10787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10787_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 19 - 330
Target Start/End: Original strand, 40253672 - 40253983
Alignment:
| Q |
19 |
gttcattgtagaaggacaatacaattggtcttgttggaagtaaatgtcacatggatattgacaattattgtttgcatttactggctgcagttgatgatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253672 |
gttcattgtagaaggacaatacaattggtcttgttggaagtaaatgtcacatggatattgacaattattgtttgcatttactggctgcagttgatgatca |
40253771 |
T |
|
| Q |
119 |
tcatagaattcaacttccttgaggttatagttttggatggaagaaggatttgttactggaatattgggaaaggaattgtgctgtgttggccaataatttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253772 |
tcatagaattcaacttccttgaggttatagttttggatggaagaaggatttgttactggaatattgggaaaggaattgtgctgtgttggccaataatttg |
40253871 |
T |
|
| Q |
219 |
gagtttgaccgataaatccaataggccataccgaatttccactctctcttttgatctcttggttttggttgaaaactcggcgagcttgagattgttgctc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253872 |
gagtttgaccgataaatccaataggccataccgaatttccactctctcttttgatctcttggttttggttgaaaactcggcgagcttgagattgttgctc |
40253971 |
T |
|
| Q |
319 |
cttcctttgctt |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40253972 |
cttcctttgctt |
40253983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University