View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10787_low_18 (Length: 247)

Name: NF10787_low_18
Description: NF10787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10787_low_18
NF10787_low_18
[»] chr2 (4 HSPs)
chr2 (18-231)||(22038594-22038807)
chr2 (18-231)||(22005651-22005861)
chr2 (117-231)||(22043307-22043421)
chr2 (24-121)||(22032321-22032418)
[»] chr6 (1 HSPs)
chr6 (18-229)||(539919-540126)


Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 22038807 - 22038594
Alignment:
18 gatggttatcttttctcctatcagtgccaactggatgagatggaacgaaagtgggaggttgcccgcggagagttacagttgcaccattccccttactagg 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||    
22038807 gatggttatcttttctcctatcagtgccaactggatgagatggaacgaaagtgggaggtttcccgcggagagttacaattgcaccattccccttactagg 22038708  T
118 tagcagtattttcactagggatacaatcacgattagcacaccagagcttgatgaaacgattgcccattacagcatccggtgccctcaaagaagcttcagc 217  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||  ||||||||||||||||||||||    
22038707 tagcagtattttcactagggaaacaatcacgattagcacaccagagcttgatgaaacgatttcccattacaacatctcgtgccctcaaagaagcttcagc 22038608  T
218 ctcttccctcttag 231  Q
    ||||||||| ||||    
22038607 ctcttccctattag 22038594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 22005651 - 22005861
Alignment:
18 gatggttatcttttctcctatcagtgccaactggatgagatggaacgaaagtgggaggttgcccgcggagagttacagttgcaccattccccttactagg 117  Q
    ||||| ||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||| |||||||| ||| |||||||||| ||||| |    
22005651 gatggatatcttttctcctatcaatgccaattggatgagatggaacgaaagtgggtggttgcccgcggggagttacaattgtaccattcccc-tacta-g 22005748  T
118 tagcagtattttcactagggatacaatcacgattagcacaccagagcttgatgaaacgattgcccattacagcatccggtgccctcaaagaagcttcagc 217  Q
    ||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||||||||||| ||| |||| |||||||| |||||||||    
22005749 tagcagtattttcactagggatacaatcacgattagcccacca-aggttgatgaaacggttgcccattacagaatcaggtgtcctcaaagcagcttcagc 22005847  T
218 ctcttccctcttag 231  Q
    ||||||||||||||    
22005848 ctcttccctcttag 22005861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 117 - 231
Target Start/End: Complemental strand, 22043421 - 22043307
Alignment:
117 gtagcagtattttcactagggatacaatcacgattagcacaccagagcttgatgaaacgattgcccattacagcatccggtgccctcaaagaagcttcag 216  Q
    |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||| || |||| |||||||||||||||||    
22043421 gtagcattattttcactagggatacaatcacgattagcccaccagagcttgatgaaatgatttcccattacagcctctggtgtcctcaaagaagcttcag 22043322  T
217 cctcttccctcttag 231  Q
    |||||||||||||||    
22043321 cctcttccctcttag 22043307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 24 - 121
Target Start/End: Original strand, 22032321 - 22032418
Alignment:
24 tatcttttctcctatcagtgccaactggatgagatggaacgaaagtgggaggttgcccgcggagagttacagttgcaccattccccttactaggtagc 121  Q
    |||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||| |||| |||||||| |||||||||||||  |||||||||||    
22032321 tatcttttcttctatcagtgccaactagatgagatggaacgaaagtgggtggttgcctgcggggagttacaattgcaccattccctctactaggtagc 22032418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 540126 - 539919
Alignment:
18 gatggttatcttttctcctatcagtgccaactggatgagatggaacgaaagtgggaggttgcccgcggagagttacagttgcaccattccccttactagg 117  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||   |||||| ||| |||||||| |||||||||||||  |||||      
540126 gatggatatcttttctcctatcagtggcaactggatgagatggaacgaaagtggg---ttgcccacggggagttacaattgcaccattcccactactac- 540031  T
118 tagcagtattttcactagggatacaatcacgattagcacaccagagcttgatgaaacgattgcccattacagcatccggtgccctcaaagaagcttcagc 217  Q
    ||  ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||| | || ||| |||||    
540030 tactagtattttcactagggatacaatcacgattagcccaccacagcttgatgaaacgattgcccattacagcatcaggtgcccttagagcagcctcagc 539931  T
218 ctcttccctctt 229  Q
    ||||||||||||    
539930 ctcttccctctt 539919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University