View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10787_low_20 (Length: 240)
Name: NF10787_low_20
Description: NF10787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10787_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 49 - 221
Target Start/End: Original strand, 32163802 - 32163974
Alignment:
| Q |
49 |
ttttctagtattagatatgcacctcataattttcacgactagaatatgcatttcttttgtttttgggtaaaatttatttatatttagataaaaatcttga |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32163802 |
ttttctagtattagatatgcacctcataattttcacgactagaatatgcatttcttttgtttttgggtaaaaattatttatatttagataaaaatcttga |
32163901 |
T |
|
| Q |
149 |
tgagataaaacgagagtggattaatatttgatataactatttttgttttaactattgattcccatgttctatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163902 |
tgagataaaacgagagtggattaatatttgatataactatttttgttttaactattgattcccatgttctatc |
32163974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University